Optimus 5-Prime

Convolutional neural network that predicts the mean ribosome load (MRL) of a fixed 50 nt human 5' untranslated region (5'UTR) from sequence alone.

Disclaimer

This is an UNOFFICIAL implementation of Human 5' UTR design and variant effect prediction from a massively parallel translation assay by Paul J. Sample, et al.

The OFFICIAL repository of Optimus 5-Prime is at pjsample/human_5utr_modeling.

The MultiMolecule team has confirmed that the provided model and checkpoints are producing the same intermediate representations as the original implementation.

The team releasing Optimus 5-Prime did not write this model card for this model so this model card has been written by the MultiMolecule team.

Model Details

Optimus 5-Prime is a simple, fully feed-forward 1D convolutional network trained on a massively parallel polysome-profiling assay of ~280,000 random 50 nt 5'UTRs upstream of an eGFP reporter expressed in HEK293T. The network ingests a fixed 50 nt 5'UTR one-hot tensor, applies three stacked padding="same" 1D convolutions (120 filters, kernel 8, ReLU) with dropout between the second/third convolutions, flattens the per-position activations channels-last, and emits a single standardized mean ribosome load (MRL) regression score through a 40-unit fully connected layer and a linear regression head. Please refer to the Training Details section for more information on the training process.

The MRL scalar is the per-sequence mean of polysome-profile-derived ribosome loading and is used by the original authors both to score natural human 5'UTRs and to engineer new sequences with predictable translation efficiency. Variant-effect scoring is performed externally by computing the MRL difference between the reference and alternative sequences; the model itself takes a single sequence as input.

Model Specification

Num Layers Hidden Size Num Parameters (M) FLOPs (M) MACs (M) Max Num Tokens
4 40 0.48 24.04 12.00 50

Links

Usage

The model file depends on the multimolecule library. You can install it using pip:

pip install multimolecule

Direct Use

Mean Ribosome Load Prediction

You can use this model directly to predict the mean ribosome load (MRL) of a fixed 50 nt 5'UTR sequence:

>>> from multimolecule import RnaTokenizer, Optimus5PrimeForSequencePrediction

>>> tokenizer = RnaTokenizer.from_pretrained("multimolecule/optimus5prime")
>>> model = Optimus5PrimeForSequencePrediction.from_pretrained("multimolecule/optimus5prime")
>>> output = model(**tokenizer("GGGACAUAGCUAGCUAGCUAGCUAGCUAGCUAGCUAGCUAGCUAGCUAGC", return_tensors="pt"))

>>> output.keys()
odict_keys(['logits'])

The pre-regression dense representation is exposed on the backbone:

>>> from multimolecule import RnaTokenizer, Optimus5PrimeModel

>>> tokenizer = RnaTokenizer.from_pretrained("multimolecule/optimus5prime")
>>> model = Optimus5PrimeModel.from_pretrained("multimolecule/optimus5prime")
>>> output = model(**tokenizer("GGGACAUAGCUAGCUAGCUAGCUAGCUAGCUAGCUAGCUAGCUAGCUAGC", return_tensors="pt"))

>>> output.keys()
odict_keys(['pooler_output'])

Interface

  • Input length: fixed 50 nt 5'UTR sequence
  • Padding: shorter sequences are right-padded with zeros to 50 nt; longer sequences are truncated to the first 50 nt
  • Alphabet: RNA (A, C, G, U); N is encoded as an all-zero channel
  • Special tokens: none added; input_ids are consumed positionally as one-hot channels
  • Output: standardized mean ribosome load score (logits) of shape (batch_size, 1); raw-MRL calibration requires the external scaler used by the upstream training workflow

Variant Effect

Optimus 5-Prime is a single-sequence regression model. To score the effect of a variant on translation, run the reference and alternative 5'UTRs through the model independently and compute the difference between their predicted MRL values:

>>> from multimolecule import RnaTokenizer, Optimus5PrimeForSequencePrediction
>>> tokenizer = RnaTokenizer.from_pretrained("multimolecule/optimus5prime")
>>> model = Optimus5PrimeForSequencePrediction.from_pretrained("multimolecule/optimus5prime")
>>> ref = "GGGACAUAGCUAGCUAGCUAGCUAGCUAGCUAGCUAGCUAGCUAGCUAGC"
>>> alt = "GGGACAUAGCUAGCUAGCUAGCUAGCUAGCUAGCUAGCUAGCUAGAUAGC"
>>> ref_mrl = model(**tokenizer(ref, return_tensors="pt"))["logits"]
>>> alt_mrl = model(**tokenizer(alt, return_tensors="pt"))["logits"]
>>> delta = (alt_mrl - ref_mrl).item()

Training Details

Optimus 5-Prime was trained to regress the per-sequence mean ribosome load (MRL) derived from polysome profiling on a massively parallel reporter assay.

Training Data

Optimus 5-Prime was trained on approximately 280,000 randomized 50 nt 5'UTRs placed upstream of an eGFP reporter and expressed in HEK293T cells. Mean ribosome load was computed per sequence from polysome-fractionation read counts. The raw sequencing data are available at GEO accession GSE114002.

Training Procedure

Pre-training

The published main_MRL_model was trained with mean-squared-error loss against standardized per-sequence MRL values. The optimizer was Adam with learning rate 1e-3, batch size 128, betas (0.9, 0.999), and epsilon 1e-8.

Citation

@article{sample2019human,
  author    = {Sample, Paul J. and Wang, Ban and Reid, David W. and Presnyak, Vlad and McFadyen, Iain J. and Morris, David R. and Seelig, Georg},
  title     = {Human 5' UTR design and variant effect prediction from a massively parallel translation assay},
  journal   = {Nature Biotechnology},
  volume    = {37},
  number    = {7},
  pages     = {803--809},
  year      = {2019},
  publisher = {Springer Science and Business Media LLC},
  doi       = {10.1038/s41587-019-0164-5}
}

The artifacts distributed in this repository are part of the MultiMolecule project. If MultiMolecule supports your research, please cite the MultiMolecule project as follows:

@software{chen_2024_12638419,
  author    = {Chen, Zhiyuan and Zhu, Sophia Y.},
  title     = {MultiMolecule},
  doi       = {10.5281/zenodo.12638419},
  publisher = {Zenodo},
  url       = {https://doi.org/10.5281/zenodo.12638419},
  year      = 2024,
  month     = may,
  day       = 4
}

Contact

Please use GitHub issues of MultiMolecule for any questions or comments on the model card.

Please contact the authors of the Optimus 5-Prime paper for questions or comments on the paper/model.

License

This model implementation is licensed under the GNU Affero General Public License.

For additional terms and clarifications, please refer to our License FAQ.

SPDX-License-Identifier: AGPL-3.0-or-later
Downloads last month
78
Safetensors
Model size
476k params
Tensor type
F32
·
Inference Providers NEW
This model isn't deployed by any Inference Provider. 🙋 Ask for provider support

Space using multimolecule/optimus5prime 1