How to use from the
Use from the
MultiMolecule library
pip install multimolecule
from multimolecule import AutoModel, AutoTokenizer

tokenizer = AutoTokenizer.from_pretrained("multimolecule/deepcpgdna-hou2016-mesc")
model = AutoModel.from_pretrained("multimolecule/deepcpgdna-hou2016-mesc")

inputs = tokenizer("ACTCCCCTGCCCTCAACAAGATGTTTTGCCAACTGGCCAAGACCTGCCCTGTGCAGCTGTGGGTTGATTCCACACCCCCGCCCGGCACCCGCGTCCGCGCCATGGCCATCTACAAGCAGTCACAGCACATGACGGAGGTTGTGAGGCGCTGCCCCCACCATGAGCGCTGCTCAGATAGCGATGG", return_tensors="pt")
outputs = model(**inputs)
embeddings = outputs.last_hidden_state

DeepCpG-DNA

DNA-only convolutional neural network from DeepCpG for predicting per-cell single-cell DNA methylation states from a CpG-centered sequence window.

Disclaimer

This is an UNOFFICIAL implementation of DeepCpG: accurate prediction of single-cell DNA methylation states using deep learning by Christof Angermueller, et al.

The OFFICIAL repository of DeepCpG is at cangermueller/deepcpg.

The MultiMolecule team has confirmed that the provided model and checkpoints are producing the same intermediate representations as the original implementation.

The team releasing DeepCpG-DNA did not write this model card for this model so this model card has been written by the MultiMolecule team.

Model Details

DeepCpG-DNA is the DNA submodule of the DeepCpG joint model. It is a 1D convolutional neural network that predicts the per-cell methylation state of a CpG site from a fixed-length 1001 bp DNA window centered on the site. The model consumes a one-hot encoded sequence and applies valid-padded convolutional blocks (Conv1D + ReLU + MaxPool) followed by a dense bottleneck and one binary classification head per single cell in the training dataset. Please refer to the Training Details section for more information on the training process.

The full DeepCpG model combines this DNA submodule with a recurrent CpG-context submodule and a joint head; this model card covers the DNA submodule only.

Variants

The DeepCpG-DNA module is trained per single-cell dataset, so each variant predicts a different number of output cells.

Dataset Architecture Cells Hub repository
Smallwood 2014 serum mESC CnnL2h128 18 deepcpgdna-smallwood2014-serum
Smallwood 2014 2i mESC CnnL3h128 12 deepcpgdna-smallwood2014-2i
Hou 2016 HCC CnnL2h128 25 deepcpgdna-hou2016-hcc
Hou 2016 HepG2 CnnL3h128 6 deepcpgdna-hou2016-hepg2
Hou 2016 mESC CnnL2h128 6 deepcpgdna-hou2016-mesc

Model Specification

Architecture Num Conv Layers Hidden Size Num Cells Num Parameters (M) FLOPs (M) MACs (M) Max Num Tokens
CnnL2h128 2 128 18 4.11 70.63 35.06 1001
CnnL3h128 3 12 4.43 165.02 82.18

Links

Usage

The model file depends on the multimolecule library. You can install it using pip:

pip install multimolecule

Direct Use

Single-Cell Methylation Prediction

You can use this model directly to predict the per-cell methylation state of a 1001 bp DNA window centered on a CpG site:

>>> from multimolecule import DnaTokenizer, DeepCpgDnaForSequencePrediction

>>> model_id = "multimolecule/deepcpgdna-hou2016-mesc"
>>> tokenizer = DnaTokenizer.from_pretrained(model_id)
>>> model = DeepCpgDnaForSequencePrediction.from_pretrained(model_id)
>>> input = tokenizer("ACGT" * 250 + "A", return_tensors="pt")
>>> output = model(**input)

>>> output.logits.shape
torch.Size([1, 18])

Each logit is a per-cell methylation score for one of the single cells in the chosen training dataset; apply a sigmoid to obtain methylation probabilities.

Interface

  • Input length: fixed 1001 bp DNA window centered on a CpG site
  • Padding: not supported; pad or crop genomic windows so they match sequence_length exactly
  • Alphabet: DNA (A, C, G, T); N is encoded as an all-zero channel
  • Output: per-cell methylation logits; the number of cells is dataset-specific (see Variants table)

Training Details

DeepCpG-DNA was trained to predict the per-cell methylation state of CpG sites from their flanking DNA context.

Training Data

DeepCpG-DNA was trained on single-cell bisulfite sequencing datasets:

  • Smallwood 2014: scBS-seq profiles of mouse embryonic stem cells, with 18 serum and 12 2i mESCs (excluding two serum cells whose methylation pattern deviated strongly from the remainder).
  • Hou 2016: scRRBS-seq profiles of 25 human hepatocellular carcinoma (HCC) cells, 6 human heptoplastoma-derived (HepG2) cells, and 6 mESCs, restricted to CpG sites covered by at least four reads.

Each training example is a 1001 bp DNA window centered on a CpG site, with a per-cell binary methylation label (methylated, unmethylated, or missing). Chromosomes were split into training, validation, and test sets to avoid sequence leakage.

Training Procedure

Pre-training

The model was trained to minimize a per-cell binary cross-entropy loss, comparing its predicted per-cell methylation probabilities (sigmoid of the per-cell logits) against the observed single-cell bisulfite labels. Missing labels are masked out during training.

  • Optimizer: Adam
  • Loss: Per-cell binary cross-entropy
  • Regularization: Dropout and L2 weight decay

Citation

@article{angermueller2017deepcpg,
  author    = {Angermueller, Christof and Lee, Heather J. and Reik, Wolf and Stegle, Oliver},
  title     = {{DeepCpG}: accurate prediction of single-cell {DNA} methylation states using deep learning},
  journal   = {Genome Biology},
  volume    = 18,
  number    = 1,
  pages     = {67},
  year      = 2017,
  publisher = {BioMed Central},
  doi       = {10.1186/s13059-017-1189-z}
}

The artifacts distributed in this repository are part of the MultiMolecule project. If MultiMolecule supports your research, please cite the MultiMolecule project as follows:

@software{chen_2024_12638419,
  author    = {Chen, Zhiyuan and Zhu, Sophia Y.},
  title     = {MultiMolecule},
  doi       = {10.5281/zenodo.12638419},
  publisher = {Zenodo},
  url       = {https://doi.org/10.5281/zenodo.12638419},
  year      = 2024,
  month     = may,
  day       = 4
}

Contact

Please use GitHub issues of MultiMolecule for any questions or comments on the model card.

Please contact the authors of the DeepCpG paper for questions or comments on the paper/model.

License

This model implementation is licensed under the GNU Affero General Public License.

For additional terms and clarifications, please refer to our License FAQ.

SPDX-License-Identifier: AGPL-3.0-or-later
Downloads last month
60
Safetensors
Model size
4.1M params
Tensor type
F32
·
Inference Providers NEW
This model isn't deployed by any Inference Provider. 🙋 Ask for provider support

Space using multimolecule/deepcpgdna-hou2016-mesc 1